Tag Archives: fungi

A Complex Fungus

Last week I mentioned I was culturing a fungus I isolated from my sink. I currently have several pure cultures growing. It has been difficult to name the little whippersnapper (I have never written whippersnapper before, it is a fine word . . .  I shall use it again in the future).

I did a DNA sequence, which proved to be somewhat helpful. Here is the ITS result:

GGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCT

ACAACGTTGCCTCGGCGGACCCCCGCCTCCCCGTAACACGGGAGCGGCCC

GCCAGAGGACCCAACAAACCCTGTTATTTTCAGTATCTTCTGAGTGAAAA

CACAATCAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGAT

GAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGA

ATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCA

TGCCTGTTCGAGCGTCATTACATCCCTCAAGCCCCTTCGGGCTTGGTGTT

GGGCATCGGCCGTCCCTCCAGCGGCGGCCGTGCCCCAAATACAGTGGCGG

TCTCGCCCCCGGCTCCTCTGCGTAGTAGTAACATCTCGCACTGGGACGGA

GCGTAGGCCACGCCGTAAAACAACCCAACTTTCTGAATGTTGACCTCGGA

TCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

After entering that sequence into GenBank I sorted through the hits. The most promising lead is Fusarium dimerum, which is actually not an individual species but is a complex instead. It seems my sink fungus is a resident of that complex.

It is possible that the structures I thought were regular micronidia are actually small macronidia (which would explain my difficulty in identifying the fungus).

Here is what it looks like in culture:

This shot shows hyphal growth on potato dextrose agar and pieces of carnation leaves. The morphological characteristics that help identify it (micronidia, macronidia, chlamydospores, ect) are microscopic features . . . so you won’t be seeing them, in this photo. 

fusarium1

Fusarium sp. on potato dextrose agar + carnation leaf cuttings

Fusarium sp. growing on potato dextrose agar

Fusarium sp. growing on V8 agar

I need to do my final write-up. That’s on the schedule for tomorrow. . .

Advertisements

4 Comments

Filed under General

Be Very, Very Quiet. . . I’m Hunting Fungi

Over the past two weeks I should have hired a camera crew to document my life. Then I could have started a reality show. Instead of Dog the Bounty Hunter, I would be called Ben the Fungus Hunter. You see, I am taking a class called Biology of Fungi. One of my assignments is to collect and identify fungal fruiting bodies.

This means I am constantly stalking fungi.

Here are a few pictures:

Thankfully my hunting trips have been more successful than Elmer Fudd’s (unless you count the Family Guy version). Not even one fungus has tried to convince me it’s not mushroom season.

Leave a comment

Filed under General

Revenge of the Mushroom

Last Saturday I went fungus collecting with my Biology of Fungi class. I picked up a few specimens, and I am drying some of them in my apartment.

This morning one of the mushrooms decided to protest. Instead of drying out nicely like the other fungi, he chose to spontaneously decompose. And the process was not odorless. The smell was about enough to knock me out.

I eradicated the offending fungus. His presence lingers. Now I’m planning to light a candle and watch the US Open final. Hopefully by the end of the day I won’t be haunted by the fungus anymore.

The offending fungus

Leave a comment

Filed under General

Mushroom Production

On Tuesday I toured the Mushroom Test Demonstration Facility at PSU. The tour was part of my Biology of Fungi class, and it was the second time I’ve been through the facility.

The Mushroom Test Demonstration Facility at PSU

The process used to grow white button mushrooms at PSU involves six steps:

Step 1- Making the Substrate. The substrate for growing button mushrooms is a compost composed of horse manure, straw, switch grass, poultry manure, water, and gypsum.

Step 2 – Finishing the Substrate. The finishing process removes pathogens from the compost by elevating the temperature. Ammonia levels must also be reduced before mushroom production can begin. The substrate is put into trays.

Step 3 – Spawning. Spawning is the equivalent of seeding. Mycelium of the fungus that has been cultured on millet grains is put on the trays. The trays are then put in a growing room, where the temperature and carbon dioxide levels can be controlled.

Step 4 – Casing. After a couple of weeks the trays should have a considerable amount of mycelium on them. A layer of peat, mixed with more fungal mycelium, is added to the top of the trays.

Step 5 – Pinning. Careful control of moisture and carbon dioxide is needed to stimulate a good crop. The mushrooms begin to form in little structures called pins. These tiny white balls grow quickly into a harvestable mushroom.

Mushrooms in various stages of growth

Step 6 – Harvest. The mushrooms are harvested by hand. Typically each tray is harvested three different times. Following the third harvest the trays are emptied, and the substrate is discarded.

Mushroom production trays

That was a relatively simple account of the mushroom production process. Each step involves various intricacies.

In Pennsylvania approximately 353 million pounds of button mushrooms are grown each year. That’s impressive. Think about how light a button mushroom is.

This morning I am headed out to the woods to hunt for mushrooms. No, I’m not planning a stir fry (as a general rule I don’t eat wild mushrooms). I need to collect a few specimens for my Biology of Fungi class.

Leave a comment

Filed under General, Photos