A Complex Fungus

Last week I mentioned I was culturing a fungus I isolated from my sink. I currently have several pure cultures growing. It has been difficult to name the little whippersnapper (I have never written whippersnapper before, it is a fine word . . .  I shall use it again in the future).

I did a DNA sequence, which proved to be somewhat helpful. Here is the ITS result:

GGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCT

ACAACGTTGCCTCGGCGGACCCCCGCCTCCCCGTAACACGGGAGCGGCCC

GCCAGAGGACCCAACAAACCCTGTTATTTTCAGTATCTTCTGAGTGAAAA

CACAATCAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGAT

GAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGA

ATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTACTCTGGCGGGCA

TGCCTGTTCGAGCGTCATTACATCCCTCAAGCCCCTTCGGGCTTGGTGTT

GGGCATCGGCCGTCCCTCCAGCGGCGGCCGTGCCCCAAATACAGTGGCGG

TCTCGCCCCCGGCTCCTCTGCGTAGTAGTAACATCTCGCACTGGGACGGA

GCGTAGGCCACGCCGTAAAACAACCCAACTTTCTGAATGTTGACCTCGGA

TCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

After entering that sequence into GenBank I sorted through the hits. The most promising lead is Fusarium dimerum, which is actually not an individual species but is a complex instead. It seems my sink fungus is a resident of that complex.

It is possible that the structures I thought were regular micronidia are actually small macronidia (which would explain my difficulty in identifying the fungus).

Here is what it looks like in culture:

This shot shows hyphal growth on potato dextrose agar and pieces of carnation leaves. The morphological characteristics that help identify it (micronidia, macronidia, chlamydospores, ect) are microscopic features . . . so you won’t be seeing them, in this photo. 

fusarium1

Fusarium sp. on potato dextrose agar + carnation leaf cuttings

Fusarium sp. growing on potato dextrose agar

Fusarium sp. growing on V8 agar

I need to do my final write-up. That’s on the schedule for tomorrow. . .

Advertisements

4 Comments

Filed under General

4 responses to “A Complex Fungus

  1. Dear Mr…Benjamin

    I’m also doing research for Fusarium but specific e.g. Fusarium oxysporum f.sp.niveum [pathogen causing wilt on watermelon]
    I also used carnation leaf for isolation confirmation..but the difference is I use water agar instead of using PDA
    By the way…how did you treat the carnation leaf? I mean for the sterilization…some article said it should be gamma radiated
    But since i don’t have any radiation tools, I just sterilized the leaves by standard autoclave, 121 atm for 20 minutes

    Any suggestion please ^_^ thanks

    • Good luck with your research.

      The PDA and carnation leaf agar that I used was prepared by someone else so I am not sure what procedure was used, though I think an autoclave was used and not radiation.

  2. hafiz`

    Hye mr.benjamin,

    im currently culturing a fungus from tree saps of aquilaria tree grown in the woods. i would like to know what does a Fusarium growth looks like? i’ve got white fur-like growth on the PDA..could be Fusarium?

    Thank you~

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Google+ photo

You are commenting using your Google+ account. Log Out / Change )

Connecting to %s